Downloading - Gtb: Fill & Download for Free

These are some things I would suggest, having travelled from MG Road to Vishvavidyalya (or GTB Nagar) on the yellow line everyday for 3 years:1. If you’re travelling towards Jahangir Puri on the yellow line and boarding between Huda City Centre to Chhatarpur, no need to travel to Huda City Centre to get a seat. You can get down at Qutub Minar and wait for a terminating metro which travels between Qutub Minar to Vishvavidyalya and hence you get an empty metro at Qutub Minar.2. Always prefer an 8 coach metro over a 6 coach metro, they tend to be faster and obviously more spacious. The last coach of the 8 coach metro is the most ideal spot in a metro, one you should always aim for. In a 6 coach metro, go for the second coach.3. In a crowded metro, carry your backpack in the front than back, keep your phone in your hand or at a safe spot and take care of all your belongings.4. Personally, I always avoided travelling in the ladies compartment because women tend to make you shift even if there’s no space and try to sit in your lap and there’s no way you can refuse. Also women are too chirpy and talkative which often caused me a headache while coming back from college. General compartment is a better bet, specially if you have a friend along so you can talk and not get creeped out by being constantly stared at.5. There are seats reserved for ladies and old and physically challenged people in the metro. While the latter have a right to their seat because it is difficult to stand in a moving train for them, ladies should avoid acting like a man is a jerk if he does not vacate that seat, sometimes someone needs it more than you do and it’s okay to stand.6. Although it is not allowed, but if there’s no seat and you really want to sit down, sitting on the floor of the metro is better than making someone shift or get up. Never been caught myself, but use this tip at your own risk.7. A long solo metro journey can become leisurely by carrying book, newspaper, iPod, or downloading movies and watching in your tab/phone.8. Try to figure out the coach and gate you should de-board from which is nearest to the escalator, if you have to travel to and fro on the same route for a long time.9. If two stations are almost equi-distant from where you are, choose the less crowded station. You will be surprised how quickly you reach the platform without getting pushed and waiting on a less crowded station. I always used to board back from GTB Nagar (less crowded) instead of Vishvavidyalya (crowded like crazy) while coming back from college, and very few people knew GTB Nagar is almost the same distance from our college as Vishvavidyalya.10. Always try shifting to a corner seat in the metro, and if the metro is too crowded and there’s no hope for a seat till your stop, claim the glass panel found on the side of each seating block.11. Everyone staying in Delhi NCR is advised to get a Smart Card, apart from the ease in travelling you get a 10% discount on each trip.12. Prefer to get metro card recharged at a station that still does it manually, you can straight away give a 500 note instead of first getting in lines to get change of 500 and then feeding it in the electronic machine to get the card recharged.13. As far as possible, avoid rush hours, 8-10am and 6-8pm (weekdays).14. Every metro station has 2 or more exit gates and the areas you can reach from different exit gates are clearly written on the station. Do not blindly exit from any gate, it may cost you in terms of auto/rickshaw fares.15. The final station of each metro is written on the top of the glass windows of the metro. Always check the destination station and if it terminates before your destination station, better to skip and take the next metro.In the end, I would like to say that Delhi Metro is the lifeline of over 2 million people. It is air-conditioned, cost-efficient, accessible and extremely clean, please do not try to damage/litter it. It is one of the best things to have happened to Delhi and it is only with the cooperation of travelers will it continue to be a world-renowned transport system. Having spent 2 hours in the metro everyday for the last 3 years and having countless experiences and a sense of attachment to the metro, this is my request to all those who use it. :)

There are many ways like, you can book a cab, take a bus or can use metro.If you are new to Delhi and don't know much about bus routes than I will suggest the use of metro.Take metro from New Delhi railway station (metro station) to GTB nagar metro station.Exit from gate no. 2 and take auto from there for Mukherjee Nagar (it's 5-10 min away from GTB Nagar).If you don't know the metro route than download Delhi Metro rail app from play store.

OK, I think I've got ABO figured out. You can get a pretty sure prediction by looking at just 2 or 3 RS- positions. But if you have a rare mutation this might not be correct, so don't bet your life on it (get a real serological test before you get a transfusion. Easiest way to do this, make a blood donation. You will get a blood donor card identifying your blood type. Upcoming blood drive. Help save lives.).TL/DR: Download and unzip your results, and grep the resulting file forthese three RSID numbers rs7853989, rs8176746, and rs8176719.rs7853989:1. If you have CC here, you are probably type BB. Goto 4.2. If you have CG here, you are probably type AB or BO. Goto 5.3. If you have GG, here, you are probably type AA or AO or OO. Goto 6.rs8176746:4. If you have CC at rs7853989, you should have TT here confirming type BB. If so goto 85. If you have CG at rs7853989, you should have TG here. If so goto 96. If you had GG at rs7853989, you should have GG here . If so goto 107. If none of those, you have a very unusual case and can't use this guiders8176719: (I=insertion, D=deletion)8. If you have CC at rs7853989, you should have II here confirming type BB. Done!9. If you had CG at rs7853989, then you should have II or ID here:—-If you have II here, you are type AB. Done!—- If you have ID here, you are type BO. Done!10. If you had GG at rs7853989, then you should have II or ID or DD here:—-If you have II here, you are type AA. Done!—-If you have ID you are type AO. Done!—-If you have DD you are type OO. Done!======================================Long story:ABO status is determined by a single gene, the ABO gene. The biology is explained nicely in this paper:Nat Struct Biol. 2002 Sep;9(9):685-90. The structural basis for specificity in human ABO(H) blood group biosynthesis. Patenaude SI, Seto NO, Borisova SN, Szpacenko A, Marcus SL, Palcic MM, Evans SV."The human ABO(H) blood group antigens are produced by specific glycosyltransferase enzymes. An N-acetylgalactosaminyltransferase (GTA) uses a UDP-GalNAc donor to convert the H-antigen acceptor to the A antigen, whereas a galactosyltransferase (GTB) uses a UDP-galactose donor to convert the H-antigen acceptor to the B antigen. GTA and GTB differ only in the identity of four critical amino acid residues. Crystal structures at 1.8-1.32 A resolution of the GTA and GTB enzymes both free and in complex with disaccharide H-antigen acceptor and UDP reveal the basis for donor and acceptor specificity and show that only two of the critical amino acid residues are positioned to contact donor or acceptor substrates. Given the need for stringent stereo- and regioselectivity in this biosynthesis, these structures further demonstrate that the ability of the two enzymes to distinguish between the A and B donors is largely determined by a single amino acid residue."Summarizing relevant bits from the rest of the paper,The ABO gene codes for a galactosyl transferase enzyme that puts the final carbohydrate on glycosyl chains attached to proteins or lipids of the red cell membrane. Functionally there are 3 alleles. The protein coded for by the A allele adds N-acetylgalactose, while the one coded for by the B allele adds galactose. These two alleles differ in only 4 out of 354 amino acids, and it is believed that two mutations, Leu266Met and Gly268Ala, are responsible for the specificity, making B antigen instead of A. A nonfunctional gene results in neither residue being added, resulting in O allele. The most common cause for O is deletion of a G base near the N terminus, resulting in frameshift or truncation of the rest of the protein. However other mutations that inactivate the enzyme can also give type O allele. O must be homozygous to give type O blood.The two relevant mutations are SNPs, rs8176746 (L266M), and rs7853989 (G268A), just 7 bases apart: rs8176746  / rs7853989  * * GTA 781 GGCGATTTCTACTACCTGGGGGGGTTCTTCGGG   261 G D F Y Y {L} G {G} F F G  GTB GGCGATTTCTACTACATGGGGGCGTTCTTCGGG   G D F Y Y {M} G {A} F F G GTO GGCGATTTCTACTACCTGGGGGGGTTCTTCGGG If you have C at rs8176746 and G at rs7853989, and you don't have some other mutations that inactivates the enzyme, you will be type A.If you have A at rs8176746 and C at rs7853989, and you don't have some other mutations that inactivates the enzyme, you will be type B.By far the most common O allele has the A signature here, so if if you have A and C respectively, the allele is pretty sure to be type B.You have two alleles, and the test won't tell which chromosome each came from. But these are so close together (highly "linked") that they will be inherited together. If you are heterozygous at both RS positions, you can be sure one chromosome has C and G (type A or O) and the other has A and C (type B).If the allele has C and G you need to look at rs8176719, the deletion: *rs8176719 GTA 241 AGGAAGGATGTCCTCGTGGTGACCCCTTGGCTGGCTCCCATTGTCTGG  81 R K D V L V V T P W L A P I V W GTB AGGAAGGATGTCCTCGTGGTGACCCCTTGGCTGGCTCCCATTGTCTGG  R K D V L V V T P W L A P I V W GTO AGGAAGGATGTCCTCGTGGT-ACCCCTTGGCTGGCTCCCATTGTCTGG  R K D V L V V {p l g w l p l s g nonsense} If you have the deletion in both rs8176719 alleles, you have no functional ABO glycosyl transferase protein, and you will be type O.If you have the deletion in one allele, that eliminates one type A enzyme. Then if you were heterozygous at the first two locations, you will be type BO, and if you were homozygous type A (C and G), you will be type AO.If you have no deletion at rs8176719, then your blood type will be AA, AB, or BB depending on the status of the first two locations.So how do you check? Download the results from your test according to the instructions from ancestry (AncestrySupport) or 23andMe: Accessing and Downloading Your Raw Data . Other testing services also provide instructions for downloading.From either organization it comes as a ZIP'ed archive containing a single huge text file. Extract that file (save the original zip file in case you want to upload to another site for analysis). The text file has a brief header with explanatory information and then some 600,000 lines, each describing one locus. Use a text editor or a utility like "grep" to find the three loci mentioned above:("position" is the number of that base in the reference human assembly build 37)1. rs7853989: CC or CG -> type B ; GG not B Ancestry (two different individuals): #rsid chromosome position allele1 allele2 rs7853989 9 136131592 G C rs7853989 9 136131592 G G 23&me (a third): # rsid chromosome position genotype rs7853989 9 136131592 GG OK here, the GG individuals should be AA, AO, or OO(the third is known to be A = AA or AO);GC would be AB or BO2. rs8176746: AA or AC -> type B ; CC not B (three different individuals, 4 tests): rs8176746 9 136131322 G G rs8176746 9 136131322 T G rs8176746 9 136131322 G G rs8176746 9 136131322 GG Here we have a problem: rs8176746 should be A or C!See below for the solution - these are on reverse strand! G=C, T=A.3. rs8176719 a deletion. Deletion gives type O allele. ancestry: rs8176719 9 136132908 D I rs8176719 9 136132908 D I 23nme rs8176719 9 136132909 -- “D” means deletion and “I” means insertion (or lack of deletion)"--" from 23andMe probably means the result was not conclusive.Can't mean deletion as this is the individual with A+ blood.The problem with interpreting rs8176746:There is one additional complication: the gene is on the reverse strand from what is reported. We can tell this because the position number reported is decreasing as we go from the N-terminal deletion mutant rs8176719 to rs7853989 to rs8176746, while position in the AA or NA sequence above is increasing. This means the nucleotide reported will be the compliment of the one in the coding sequence given above. This is somewhat confirmed by the first sentence at rs8176746Final Summary: sequencing results give base on the ref strand, not coding strandrs8176746: A -> type B ; C not B prot AA codon coding ref DNAreport distribution GTA: L266 (Ctg) C G G G=0.88220 GTB: M266 (Atg) A T T T=0.11779 But on the other hand rs7853989 is reported on the coding strand:rs7853989: C -> type B ; G not B prot AA codon coding ref DNAreport distribution GTA G268 (gGg) G C G G=0.86743  GTB: A268 (gCg) C G C C=0.13256 No problem for rs8176719 because it is a deletion (or not) on either strand.another resource for snps:https://www.ncbi.nlm.nih.gov/snp/rs8176746#frequency_tab