Genbank Sample Record: Fill & Download for Free

The most common format before is the FASTA file format: records start with ‘>’ followed by the name of the sequence, then an optional space and any comment text on the same line, a newline, then the sequence (generally 60 - 80 characters per line), and then a blank line between records:>To52–2 an example sequence taatacagagatccgaaagaactctaaggaaaacttgttttggaaaagtatggaaccgag ttttatattctacaccggtaccctcttgctgtccggcctttctacacaatgccatgtcgt gacaacgagttgtatagcaactcatttgatgttttcattagaggggaggagataatttca ggagctcaacgtgtgcacatacctgaacttttggaggcacgtgcaactgcatgtgggatt gatctcaaaaccatatcatcatacattgattccttcaggtatggtgcgcctccacatggc gggattggagttggattggaacgtgttgtgatgcttttttgtggccttgataacattcgt aaagtctcacttttcccacgtgaccttcg You’ll also find that people have sequence in the old GCG format as well:!!NA_SEQUENCE 1.0 To52–2.seq Length: 389 February 17, 1997 12:34 Type: N .. 1 taatacagagatccgaaagaactctaaggaaaacttgttttggaaaagtatggaaccgag 61 ttttatattctacaccggtaccctcttgctgtccggcctttctacacaatgccatgtcgt 121 gacaacgagttgtatagcaactcatttgatgttttcattagaggggaggagataatttca 181 ggagctcaacgtgtgcacatacctgaacttttggaggcacgtgcaactgcatgtgggatt 241 gatctcaaaaccatatcatcatacattgattccttcaggtatggtgcgcctccacatggc 301 gggattggagttggattggaacgtgttgtgatgcttttttgtggccttgataacattcgt 361 aaagtctcacttttcccacgtgaccttcg EMBL (example: CAA39891) and GenBank (GenBank Sample Record) have formats that interleave sequence annotations and the sequence. The stained format is the same as FASTA but without the header line (really only suitable for one sequence per file).Automated sequencers also use variations like FastQ, which is a FASTA-like format developed by Illumina that incorporates encoded base call quality information in the sequence:@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC … and there are also separate formats for sequence alignments as well.

Is the US banning travel from the UK as a result of the covid mutation that originated there?Travel since February 2019Both the UK and the US are suffering from economic crises. Cutting travel. It’s really too late the use travel bans as the primary measure for keeping the mutated virus out of the US. The ban against China travelers coming to the US and, eventually, the ban against European travelers had little effect.Although some of the recent analyses identify the first US case of SARS-CoV-2 infection as coming into from the US or from Europe, the one we all saw and acted upon was in an American traveler returning from a visit to family in Wuhan, China. Trump used an executive order to ban people coming from China—unless they were Americans. The single measure used to identify infection was an increased temperature.We’ve learned a lot since then, including the recognition that people can be infected and transmit the virus for up to 10 days after infection—with no symptoms. We’ve also learned that a fever occurs in about half of infected people. A dry cough is possibly a more telling feature of COVID-19.The reference virus SARS-CoV-2 WSHU01In terms of the virus, SARS-CoV-2 has been identified as a coronavirus with a lower mutation rate compared with other coronaviruses. Some things to remember about mutations:Mutations are random and are not driven by external forces.Mutations are not inherently good or bad.There are many different types of mutation. [see list of some later in answer]A “mutant” virus simply has one or more nucleotides different from the sequence selected as the “original” or reference sequence—isolate 2019-nCoV WHU01 (GenBank accession number MN988668 ). Chinese scientists published this sequence and distributed it to the world in January 2020. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China“The final genome sequence of SARS-CoV-2 consists of a single, positive-stranded RNA that is 29,811 nucleotides long, broken down as follows: 8,903 (29.86%) adenosines, 5,482 (18.39%) cytosines, 5,852 (19.63%) guanines, and 9,574 (32.12%) thymines.” https://mra.asm.org/content/ga/9/11/e00169-20.full.pdf [Note: Since the RNA is single-stranded, base-pairing doesn’t apply and C doesn’t have to match G, etc]. Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, co“In total, 10 022 SARS CoV-2 genomes from 68 countries were analyzed. Most genomes came from the United States of America (3543 samples), followed by the United Kingdom of Great Britain and Northern Ireland (1987 samples), and Australia (760 samples).”The researchers detected a total of 65776 variants with 5775 distinct variants. The 5775 distinct variants consist of the following:2969 missense mutations,1965 synonymous mutations,484 mutations in the non-coding regions,142 non-coding deletions,100 in-frame deletions,66 non-coding insertions,36 stop-gained variants,11 frameshift deletions and2 in-frame insertions Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, co [The relationship between variant and strain is not clear—the words have been used differently by different laboratories.]The UK variant“The UK variant is just one variation among many that have arisen as the coronavirus SARS-CoV-2 has spread around the world. Mutations arise as the virus replicates, and this variant — known as B.1.1.7 — has acquired its own distinctive set of mutations.” The U.K. Coronavirus Variant: What We Know“The variant came to the attention of researchers in December 2020, when it was found more frequently in samples from parts of southern England.” Later, it was determined that it may have been seen as early as September.When researchers took a close look at its genome, they found the virus had accumulated a relatively large number of mutations — 23 in total— compared with the standard genome. Some mutations in strain B.1.1.7 looked as if they could potentially affect how the virus spread. The U.K. Coronavirus Variant: What We KnowHow is the UK variant different in terms of human infection and symptoms?A specific variant being found more often is not proof that it spreads faster than others. The southeast includes London the densest population of the area. Where is London?“Neil Ferguson, an epidemiologist at Imperial College London, estimates that the variant has an increased transmission rate of 50 to 70 percent compared to other variants in the United Kingdom.” The U.K. Coronavirus Variant: What We KnowDoes this variant cause a more severe version of COVID?Although there is no strong evidence that the UK variant is more serious, a variant with a specific mutation to one found in B.1.1.7 has also been found in the coastal area. Preliminary studies suggest that people infected with South Africa variant carry a heightened viral load — a higher concentration of the virus in their upper respiratory tract. In many viral diseases, this is associated with more severe symptoms.What about the two vaccines with Emergency Use Authorization?“Most experts doubt that it will have any great impact on vaccines, although it’s not yet possible to rule out any effect.” The U.K. Coronavirus Variant: What We KnowHow do we in the US react?Our record on SARS-CoV-2 is somewhat spotty. Some still believe it’s a hoax. Others, especially those who saw a family member die, may get more worried than they already are.Dr. Fauci and I agree. Don’t be scared by changing information and regulations. Do what the scientists and medical personnel have been saying all along:Wash your hands thoroughly and often—every time you touch something “dirty”.Avoid close contact—6 to 12 feet, please. Stay away from groups of people packed into a room that barely contains them. Your old or new friend maybe just the one who is infected and doesn’t know it yet.Wear a mask. If you can’t breathe with a fabric mask, get a clear one like the professionals wear. You can see everyone, talk with them, and be protected from them when they sing, cough, or sneeze.Keep your hands away from your face. Your mouth, nose, and eyes are there and you need to protect them.The person you most trust may be the one who can give you SARS-CoV-2. Is COVID the gift you want this holiday season? Coronavirus Disease 2019 (COVID-19) – Prevention & Treatment

It is a man-made bioweapon released from China.In 1999, Li-Meng Yan, the Chinese virologist (censored off various social media platforms) affiliated with the University of Hong Kong’s School of Public Health, worked in Ft. Detrick to teach ebola how to infect human cells without killing them. Ebola couldn’t otherwise infect humans.She then worked undercover in the WHO reference laboratory at the University of Hong Kong. The information she received from her network in mainland China, alongside with her experience in virology, confirmed her suspicions that the novel coronavirus was made in a laboratory.Dr. Leo Poon, Yan’s supervisor at that time, asked her in Dec. 2019 to examine the odd cases in mainland China similar to the Severe Acute Respiratory Syndrome (SARS). She reported her findings and Poon just nodded and told her to continue working. In January, she had more to share with him. He warned her to “keep silent, and be careful. Don’t touch the red line. We will get in trouble and we’ll [disappear].”“A sense of right and wrong” emboldened her to shared her findings with U.S.- based, Hong Kong blogger Lu Deh, who suggested that she relocate somewhere else for her safety.She had discovered biological evidence that a template virus (ZC45/ZXC21) was engineered over six months to become SARS-CoV2. Wuhan virologists went beyond gain-of-function research to engineer the new bio-weapon, and even used data fabrications to cover up the origin of SARS-CoV2.Allegedly, the RaTG13 (RaBtCoV/4991) virus was obtained from bat feces in 2013. Since it is 96% similar to the SARS-CoV-2 sequence, published at GenBank, the CCP claims that both must be naturally occurring because they were supposedly taken from the same fecal sample. Note that the CCP destroyed all evidence of RaTG13 so that, "No independent verification of the RaTG13 sequence seems possible because,” according to Dr. Zhengli Shi. However, the process for sequencing DNA itself “leaves room for potential fraud” and “RNA viral genome can be fabricated on GenBank with careful execution”. There are 5 problems with this lie that SARS-CoV-2 is natural: 1) fecal samples are typically 70-90% bacterial, not 1.7%. 2) RaTG13 contains segments of DNA from foxes, flying foxes, and squirrels. 3) No live virus or intact genome has ever been isolated or recovered in nature for RaTG13. 4) The spike genes of SARS-CoV-2 and RaTG13 evidence no natural evolution when compared to sequences of naturally-evolving coronaviruses. The RBM region of the S1/spike of the RaTG13 strain had be edited in order to retain the 96.2 percent sequence identity. 5) “All fabricated coronaviruses share a 100% amino acid sequence identity on the E protein with ZC45 and ZXC21,” a process that served as a template for the creation of SARS-CoV-2.The way the sequence can be changed is that after the genomic sequence is created on a computer, segments of the genome can be synthesized based on the sequence. After amplifying each DNA segment through PCR, the researcher can send the PCR products for sequencing. These may contain sequencing samples from an alleged host that are mixed with genetic material from the host, which is ultimately (fraudulently) used to determine the sequence of the virus from these “raw sequencing reads” which are then published on GenBank. This laboratory concoction, fused with a host and amplified, can then be used as false evidence to declare the virus to be a “natural-occurring” version of the corresponding virus.She published her findings in a 26-page report co-written with three other scientists, citing “evidence left in the genome.” The template used to create the virus came from the Chinese military. Since then, she has been warning that SARS-CoV-2 is an “unrestricted bio-weapon” that was not only created in a Wuhan lab, but was also released intentionally by the Chinese Communist Party (CCP).The CCP, not wanting this made public, demanded the suspension of her Twitter account and targeted her for “disappearance.” Yan managed to elude surveillance and board a plane out of China at the cost of no longer seeing her husband, friends, and other loved ones again, and then fled Hong Kong on 4/28/20 via a Cathay Pacific flight to America.Other whistleblowers who exposed the truth have not been so lucky. For example, journalist and lawyer Chen Qiushi and businessman Fang Bin have both been reported missing. (Chen captured videos of overflowing hospitals, funeral homes and isolation wards a day after arriving at Wuhan – the center of the pandemic. Chen was then put in “quarantine” by Feb. 6, with no subsequent news about him. Meanwhile, Bin posted a series of videos showing piles of dead bodies in a city hospital. The last video he posted showed men in protective suits knocking on his door).During a Tucker Carlson Tonight interview on Fox News, Yan described the virus as a “Frankenstein” strain genetically engineered and designed to target humans, and it was intentionally released. https://www.bitchute.com/video/IB3ijQuLkkUr/In 2005, Dr. Yang specified the criteria for a pathogen to qualify as a bioweapon:It is significantly virulent and can cause large scale casualty.It is highly contagious and transmits easily, often through respiratory routes in the form of aerosols. The most dangerous scenario would be that it allows human-to-human transmission.It is relatively resistant to environmental changes, can sustain transportation, and is capable of supporting targeted release.All of the above criteria have been met bySARS-CoV-2: it has taken hundreds of thousands lives, led to numerous hospitalizations, and left many with sequela and various complications; it spreads easily by contact, droplets, and aerosols via respiratory routes and is capable of transmitting from human to human, the latter of which was initially covered up by the CCP government and the WHO and was first revealed by Dr. Li-Meng Yan on January 19th, 2020 on Lude Press; it is temperature-insensitive (unlike seasonal flu) and remains viable for a long period of time on many surfaces and at 4°C (e.g. the ice/water mixture).What's more, COVID-19 spreads asymptomatically, which "renders the control of SARS-CoV-2 extremely challenging."Since the genomic sequence was manipulated, the precise genomic sequence of the correct strain was likely not discovered by the companies manufacturing the COVID vaccines. What if the CCP is preparing to unleash even more lethal bio-weapons? If China’s scientific fraud and bio-weapon research is not halted, then what’s stopping the rogue communist regime from unleashing a new bio-weapon every six months to stealthily perpetuate outbreaks that can be engineered to subvert detection?Yan isn’t the only expert to prove the COVID-19 is manmade. Back in 2003, the CCP attempted to swindle the world into accepting a vaccine for its coronavirus version 1.0. Later on, Dr. Shi Zhengli inserted an HIV segment into a coronavirus from horseshoe bats, making it more infectious and lethal. Horseshoe bats carry SHC014-CoV virus which can be transmitted to humans by binding to ACE2 receptors and multiply in the cells of the respiratory system.From 2007 and 2017, Shi Zhengli and colleagues created at least eight new chimeric coronaviruses with a variety of RBMs.Meanwhile, in the USA, work on this bioweapon was also being done at the University of North Carolina, Chapel Hill, at Harvard, at Ft. Detrick, at the US Army Research Institute of Infectious Disease, and at the Food and Drug Administration’s lab in Arkansas.In 2015, the US imposed a moratorium because there was no justification for working with coronaviruses since nothing good could result; only bad. Nevertheless, development of a biological weapon continued through 2015, combining the HSC-014 coronavirus with the stars coronavirus, then adding HIV and Mers for “gain of function” (genetically mutated to make it more harmful & dangerous).This research was Published: 09 November 2015A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence [by Vineet D Menachery, Boyd L Yount Jr, Kari Debbink, Sudhakar Agnihothram, Lisa E Gralinski, Jessica A Plante, Rachel L Graham, Trevor Scobey, Xing-Yi Ge, Eric F Donaldson, Scott H Randell, Antonio Lanzavecchia, Wayne A Marasco, Zhengli-Li Shi, Ralph S Baric. Nature Medicine volume 21, pages1508–1513 (2015)]Due to the moratorium in the USA, the coronavirus was delivered to China along with $3.7M from NIAID within NIH, approved by Fauchi. It appears that Fauchi deliberately broke the law in several ways. Prof. Ralph S. Baric (University of North Carolina) received major grants from Anthony Fauci’s National Institute of Allergy and Infectious Diseases (NIAID). “Fauci was a big proponent of ‘gain of function’ research, and when this was prohibited at Baric’s lab because it was considered to be too dangerous, the research was shifted to China,” Mosher explained. In China, this work on a bioweapon was continued at the Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan.China supplied the Wuhan Bat Virus which was used in the American study.It was jointly funded by the National Natural Science Foundation of China (81290341, 31621061) to ZLS, China Mega-Project for Infectious Disease (2014ZX10004001-003) to ZLS, Scientific and technological basis special project (2013FY113500) to YZZ and ZLS from the Ministry of Science and Technology of China, the Strategic Priority Research Program of the Chinese Academy of Sciences (XDPB0301) to ZLS, the National Institutes of Health (NIAID R01AI110964), the USAID Emerging Pandemic Threats (EPT) PREDICT program to PD and ZLS, CAS Pioneer Hundred Talents Program to JC, NRF-CRP grant (NRF-CRP10-2012-05) to LFW and WIV “One-Three-Five” Strategic Program (WIV-135-TP1) to JC and ZLS.Pandemic.news shows how France and the US provided the CCP with the financial and scientific resources needed to develop this bioweapon.Additional funding was provided by the CIA and USAID-EPT-PREDICT funding from EcoHealth Alliance, to Z.-L.S. USAID is a front for American bio-warfare research such as that done in Tbilisi, Georgia.Laboratory materials, samples and equipment used were obtained from the Army Medical Research Institute of Infectious Diseases.In 2017, at Georgetown, Fauchi is recorded warning that Trump will face a pandemic which hopefully, by killing millions of citizens and ruining the economy, would bring him down.In 2019, the United States National Institutes of Health (NIH) actually gave the Wuhan Institute of Virology $3.7 million more, as part of a grant entitled, Understanding the Risk of Bat Coronavirus Emergence (this link).Fauci is directly to blame for this global plandemic, which was hatched and unleashed with the help of American taxpayer dollars that Fauci redirected towards this nefarious research.Some skeptics still believe the virus was natural. However, a 1/24/20 study published in The Lancet found that three of the first four cases - including the first known case - didn't provide a documented link to the Wuhan wet market. In addition, the bats that carry the family of coronaviruses linked to the new strain aren't found within 100 miles of Wuhan — but they were being studied in both local laboratories!There is simply no way that COVID-19 was able to transfer from bats to humans without some kind of deliberate genetic tampering, contends Prof. Giuseppe Tritto, a renowned biotechnology expert and President of the World Academy of Biomedical Sciences and Technologies (WABT). In his book, China COVID 19: The Chimera That Changed The World, Tritto explains how Shi Zhengli isolated RaTG13 in 2013 from Yunnan horseshoe bats of the Rhinolophus affinis variety. This was genetically modified to become COVID-19.Norwegian and British vaccine scientists have published what seems to be unequivocal evidence that SARS-CoV-2, the coronavirus responsible for the COVID-19 pandemic, is man-made. Researchers in India, China, etc. are reaching the same conclusion because:The mutations that would normally be seen in the course of animal to human transmission have not occurred in SARS-CoV-2, indicating that it was fully “pre-adapted” for human infection.The COVID-19 has an affinity for human ACE2 receptors over any other. SARS-CoV-2 has insertions in its protein sequence that have never been detected in nature and contribute to its infectivity and pathogenicity. The SARS-CoV-2 has a receptor binding domain specifically designed for the human angiotensin converting enzyme-2 receptor (ACE2) found in human lungs, kidneys, intestines and blood vessels.The SARS-CoV-2 has a strange furin polybasic cleavage site that its closest genetic relative, RaTG-13, does not have. It is not found in any closely-related bat coronaviruses as well as other artificially inserted charged amino acids that enhance the virus’ ability to bind to and enter human cells by forming “salt bridges” between the virus and the cell surface. This cleavage site makes the Wuhan coronavirus (COVID-19) substantially more infectious than other coronaviruses.The COVID-19 pandemic is revealing neurological, haematological and immunological pathogenicity, which cannot be explained by infectivity via the ACE2 receptor alone. There have been wide-ranging clinical observations such as a loss of taste and smell, sore throat, dry cough, headache and severe gastrointestinal pain with diarrhea.SARS-CoV-2 binding to the bitter/sweet receptors in the upper respiratory tract provides a perfect location for transmission by coughing. Oral and upper respiratory infection can lead to transmission to the lower respiratory tract, gastrointestinal effects and a cascade of inflammation-producing immunological responses. The wide-spread systemic release of the virus, due to its co-receptor enhancement, could explain the multiple clinical findings on the cardiovascular system, immunological T-cells, cells associated with neuropathological conditions and, finally, the severe hypoxia seen in advanced cases of the disease.A Swiss research team was able to create a synthetic clone of COVID-19 by inserting genetic fragments proving it to be an “obvious chimera” (a combination of at least two pre-existing viruses). Yuri Deigin says that the Wuhan coronavirus (COVID-19) is based on an ancestral bat strain of coronavirus known as RaTG13, but with a replaced receptor binding motif (RBM) in its spike protein.COVID-19 also contains an added stretch of four different amino acids that had to have been inserted into the virus, creating a furin cleavage site “that, as virologists have previously established, significantly expands the ‘repertoire’ of the virus in terms of whose cells it can penetrate.” Virologists like Shi Zhengli have “done many similar things in the past,” including replacing the RBM in one type of virus with the RBM of another. They have also added new furin sites to coronaviruses, creating new artificial species-specific coronaviruses that borrow from other coronaviruses in their ability to do new things.Dr. Ronen Shemesh, an Israeli geneticist who is working on developing a treatment for the Wuhan coronavirus (COVID-19) claims, “There are many reasons to believe that the COVID-19 generating SARS-CoV-2 was generated in a lab, most probably by methods of genetic engineering. I believe that this is the only way an insertion like the furin protease cleavage site could have been introduced directly at the right place and become effective. I believe that the most important issue about the differences between all coronavirus types is the insertion of a furin protease cleavage site at the spike protein of SARS-CoV-2. Such an insertion is very rare in evolution. The addition of four such amino acids alone in the course of only 20 years is very unlikely.”The odds of this insertion happening in precisely the right place of the cleavage site of the spike protein to make the virus more infectious are exceptionally low. Dr. Shemesh adds, “What makes it even more suspicious is that fact that this insertion not only occurred on the right place and in the right time, but also turned the cleavage site from a Serine protease cleavage site to a furin cleavage site. This protein cleaving protein is highly promiscuous. It’s found in many human tissues and cell types and is involved in many other virus types (and) activation and infection mechanisms (it is involved in HIV, Herpes, Ebola and Dengue virus mechanisms).”Professor Luc Montagnier, 2008 Nobel Prize in Medicine for discovering HIV as the cause of AIDS, claims that SARS-CoV-2 is a manipulated virus that was accidentally released from a laboratory in Wuhan, China.Chinese researchers are said to have used coronaviruses in their work to develop an AIDS vaccine; HIV DNA fragments were found in the SARS-CoV-2 genome. “With my colleague, bio-mathematician Jean-Claude Perez, we carefully analyzed the description of the genome of this RNA virus,” explains Luc Montagnier, interviewed by Dr Jean-François Lemoine. In order to insert an HIV sequence into this genome, molecular tools are needed, and that can only be done in a laboratory. The altered elements of this virus are eliminated as it spreads: “Nature does not accept any molecular tinkering, it will eliminate these unnatural changes and even if nothing is done, things will get better, but unfortunately after many deaths.” Indian researchers scanned the novel coronavirus genome and found unique cell identification and membrane binding proteins located in the HIV genome, suggesting the 2019-nCov is a laboratory-made chimera. Pressure from China and their allies forced the Indian researchers to withdraw their published findings.U.S. intelligence agencies received reports based on publicly available cellphone and satellite data suggesting there may have been a shutdown at the lab. NBC News citing cellphone activity data showed a complete shutdown of a high-security section of the lab for 2.5 weeks between Oct. 7 and Oct. 24. The report, obtained by the London-based NBC News Verification Unit. So, the release may not have been intentional."Would be interesting if someone analyzed commercial telemetry data at & near Wuhan lab from Oct-Dec 2019," Rubio tweeted. "If it shows dramatic drop off in activity compared to previous 18 months it would be a strong indication of an incident at lab & of when it happened.President Donald Trump announced that intelligence he has been shown gives him a “high degree of confidence” that the Wuhan coronavirus (COVID-19) pandemic originated at the WIV. British Cabinet Ministers had likewise announced similar findings roughly a month prior to this, backing Trump’s later claims.They had seen several pictures later removed from the WIV website: 1) depicted school staff members entering a cave to take swabs from bats carrying various coronaviruses. None of these staff members were wearing proper protective equipment in the photo, suggesting that they may have contracted the virus from these tainted bats. 2) Rick Switzer, a science and technology expert from the U.S. embassy in Beijing who visited in March 2018 and warned the State Department, “During interactions with scientists at the WIV laboratory, they noted the new lab has a serious shortage of appropriately trained technicians and investigators needed to safely operate this high-containment laboratory.” 3) A third photo, showed a broken seal on one of the lab’s refrigerators holding 1,500 different coronavirus strains, any or all of which could have escaped because of this. Interestingly, the WIV web site does admit that “once the test tube for storing viruses is opened in the laboratory, it is like opening the Pandora’s Box.”Video evidence (this link) shows China’s own government workers admitting on camera that the work being done with coronavirus bats is risky and has the great potential to unleash a pandemic. “We can easily get contact with the feces of bats which contaminate everything,” says Tian Junhua, a researcher who works at the nearby Wuhan Centre for Disease Control. “So it is highly risky here,” he adds. “I feel the fear. The fear of infections.” A coronavirus typically acquires one mutation a month.The timeline created by NBC News supports suspicions that the virus may have leaked from a lab:A Jan. 24 study published in the medical journal The Lancet found that three of the first four cases - including the first known case - didn't provide a documented link to the Wuhan wet market.The bats that carry the family of coronaviruses linked to the new strain are obtained in Yunnan, more than 1,000 miles away from Wuhan open-air, food markets…where, in Wuhan labs, they were being studied.Photos and videos have emerged of researchers at both labs collecting samples from bats without wearing protective gear, which experts say poses a risk of human infection.A U.S. State Department expert who visited the WIV in 2018 wrote in a cable reported by The Washington Post: "During interactions with scientists at the WIV laboratory, [U.S. diplomats] noted the new lab has a serious shortage of appropriately trained technicians and investigators needed to safely operate this high-containment laboratory."According to Senate Intelligence Committee member Tom Cotton, R-Ark., the Chinese military posted its top epidemiologist to the WIV in January.The Shanghai laboratory where researchers published the world's first genome sequence of the coronavirus was shut down Jan. 12, according to The South China Morning Post.According to U.S. intelligence assessments, including one published by the Department of Homeland Security and reviewed by NBC News, the Chinese government initially covered up the severity of the outbreak. Government officials threatened doctors who warned their colleagues about the virus, weren't candid about human-to-human transmission and still haven't provided virus samples to researchers.RaBtCoV/4991 was allegedly discovered by 'Batwoman' Shi and colleagues in 2012 and published in 2016, and colleagues have been asking if it's the same virus as RaTG13.Given the 100% identity on this short gene segment between RaBtCoV/4991 and RaTG13, the field has demanded clarification of whether or not these two names refer to the same virus. Dr. Shi would not respond. The answer finally came from Peter Daszak, president of EcoHealth Alliance and long-term collaborator of Shi, who claimed that was RaTG1327.It makes sense that the two would be the same. Shi and her team wouldn't have conducted whole genome sequencing of RaBtCoV/4991 before 2020, as it was suspected in the deaths of miners who suffered from severe pneumonia after clearing out bat droppings in a Chinese mineshaft. Given the Shi group’s consistent interests in studying SARS-like bat coronaviruses and the fact that RaBtCoV/4991 is a SARS-like coronavirus with a possible connection to the deaths of the miners, it is highly unlikely that the Shi group would be content with sequencing only a 440-bp segment of RdRp and not pursue the sequencing of the receptor-binding motif (RBM)-encoding region of the spike gene. In fact, sequencing of the spike gene is routinely attempted by the Shi group once the presence of a SARS-like bat coronavirus is confirmed by the sequencing of the 440-bp RdRp segment 25, 32, although the success of such efforts is often hindered by the poor quality of the sample."Clearly, the perceivable motivation of the Shi group to study this RaBtCoV/4991 virus and the fact that no genome sequencing of it was done for a period of seven years (2013-2020) are hard to reconcile and explain.” Meanwhile, genomic sequencing of RaTG13 was conducted in 2018.Second, why did Shi delay publication on RaTG13 until 2020 when it's got a Spike protein that can bind with human ACE2 receptors?...if the genomic sequence of RaTG13 had been available since 2018, it is unlikely that this virus, which has a possible connection to miners’ deaths in 2012 and has an alarming SARS-like RBM, would be shelved for two years without publication. Consistent with this analysis, a recent study indeed proved that the RBD of RaTG13 (produced via gene synthesis based on its published sequence) was capable of binding hACE2.Third, there has been no follow-up work on RaTG13 by Shi's group. Upon obtaining the genomic sequence of a SARS-like bat coronavirus, the Shi group routinely investigate whether or not the virus is capable of infecting human cells. This pattern of research activities has been shown repeatedly. However, such a pattern is not seen here despite that RaTG13 has an interesting RBM and is allegedly the closest match evolutionarily to SARS-CoV-2Direct genetic evidence proving RaTG13 is fraudulent also comes from Yan's group which closely examined the sequences of specific spike proteins for relevant viruses. They specifically compared mutations and found that the spike genes of SARS-CoV-2 and RaTG13 do not contain evidence of natural evolution when compared to other coronaviruses which naturally evolved.A logical interpretation of this observation is that SARS-CoV-2 and RaTG13 could not relate to each other through natural evolution and at least one must be artificial. If one is a product of natural evolution, then the other one must be not. It is also possible that neither of them exists naturally. If RaTG13 is a real virus that truly exists in nature, then SARS-CoV-2 must be artificial.It is also highly likely that the sequence of the RaTG13 genome was fabricated by lightly modifying the SARS-CoV-2 sequence to achieve an overall 96.2% sequence identity. During this process, much editing must have been done for the RBM region of the S1/spike because the encoded RBM determines the interaction with ACE2 and therefore would be heavily scrutinized by others.Evidence clearly indicates that the novel coronaviruses recently published by the CCP-controlled laboratories are all fraudulent and do not exist in nature.One final proof of this conclusion is the fact that all of these viruses share a 100% amino acid sequence identity on the E protein with bat coronaviruses ZC45 and ZXC21, which, as revealed in our earlier report1, should be the template/backbone used for the creation of SARS-CoV-2. Despite its conserved function in the viral replication cycle, the E protein is tolerant and permissive of amino acid mutations. It is therefore impossible for the amino acid sequence of the E protein to remain unchanged when the virus has allegedly crossed species barrier multiple times (between different bat species, from bats to pangolins, and from pangolins to humans). The 100% identity observed here, therefore, further proves that the sequences of these recently published novel coronaviruses have been fabricated.Yan notes that while it's not easy for the public to accept that SARS-CoV-2 is a bioweapon due to its relatively low lethality, it indeed meets the criteria of a bioweapon. In 2005, Dr. Yang specified the criteria for a pathogen to qualify as a bioweapon:It is significantly virulent and can cause large scale casualty.It is highly contagious and transmits easily, often through respiratory routes in the form of aerosols. The most dangerous scenario would be that it allows human-to-human transmission.It is relatively resistant to environmental changes, can sustain transportation, and is capable of supporting targeted release.All of the above have been met bySARS-CoV-2: it has taken hundreds of thousands lives, led to numerous hospitalizations, and left many with sequela and various complications; it spreads easily by contact, droplets, and aerosols via respiratory routes and is capable of transmitting from human to human, the latter of which was initially covered up by the CCP government and the WHO and was first revealed by Dr. Li-Meng Yan on January 19th, 2020 on Lude Press; it is temperature-insensitive (unlike seasonal flu) and remains viable for a long period of time on many surfaces and at 4°C (e.g. the ice/water mixture).What's more, COVID-19 spreads asymptomatically, which "renders the control of SARS-CoV-2 extremely challenging.” "In addition, the transmissibility, morbidity, and mortality of SARS-CoV-2 also resulted in panic in the global community, disruption of social orders, and decimation of the world’s economy. The range and destructive power of SARS-CoV-2 are both unprecedented.” Clearly,SARS-CoV-2 not only meets but also surpasses the standards of a traditional bioweapon. Therefore, it should be defined as an Unrestricted, manmade, deliberately released, Bioweapon, as an act of war.If you’ve any evidence contrary to what I’ve presented here, please let me know.